LOC100000009

Ensembl ID:
ENSDARG00000075648
Human Orthologue:
SEMA5B
Human Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh
Mouse Orthologue:
Sema5b
Mouse Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12594 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087661 Nonsense 224 1098 5 20
Genomic Location:
Chromosome 6 (position 3979191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCATCATTTACCGCAGCCTGGGGAACATGCCGCCTYTGCGCACYGCA[C/T]AGTACAACTCTAAATGGCTCAACGGTACAGCAAACAACAACAATTTAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v0nsyiuu