LOC100000009

Ensembl ID:
ENSDARG00000075648
Human Orthologue:
SEMA5B
Human Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh
Mouse Orthologue:
Sema5b
Mouse Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12594 Nonsense Available for shipment Available now
sa26663 Nonsense Mutation detected in F1 DNA During 2015
sa26664 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa12594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087661 Nonsense 224 1098 5 20
Genomic Location:
Chromosome 6 (position 3979191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCATCATTTACCGCAGCCTGGGGAACATGCCGCCTYTGCGCACYGCA[C/T]AGTACAACTCTAAATGGCTCAACGGTACAGCAAACAACAACAATTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087661 Nonsense 239 1098 6 20
Genomic Location:
Chromosome 6 (position 3979582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCATCCTCCTTTTTCTCTGTGCAGATCCTCACTTCATCTCGGCGTA[T/G]GAGGTGAGCCGTTTCACATACGTGTTTCTGCGAGAGAACGCAGTGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087661 Essential Splice Site 975 1098 18 20
Genomic Location:
Chromosome 6 (position 4012411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACTCTAGTGCTGTCAAAAGGACAGAAGAGGAGCACAAACTGTGGAG[G/A]TGAGTCGAAAATTTACACCACCAGACAAAGATTGGAAACTTTAGCATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v0nsyiuu