GIGYF1 (1 of 3)

Ensembl ID:
ENSDARG00000075647
Description:
GRB10 interacting GYF protein 1 [Source:HGNC Symbol;Acc:9126]
Human Orthologue:
GIGYF1
Human Description:
GRB10 interacting GYF protein 1 [Source:HGNC Symbol;Acc:9126]
Mouse Orthologue:
Gigyf1
Mouse Description:
GRB10 interacting GYF protein 1 Gene [Source:MGI Symbol;Acc:MGI:1888677]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34046 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31566 Nonsense Mutation detected in F1 DNA During 2017
sa20912 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109594 Essential Splice Site 55 1017 2 25
Genomic Location (Zv9):
Chromosome 7 (position 22018665)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20609101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGATACGGCCGAGAGGAGATGCTAGCACTTTATGTCAAAGACAACAAG[G/A]TAAGAAAAAGATTTAAACAAATCGGCCTAATTTTTAAGCTTAGGTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109594 Nonsense 427 1017 10 25
Genomic Location (Zv9):
Chromosome 7 (position 22028951)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20619387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGCCACCGGGGGGTGATATTGAGGACGACGAGGGCATGAAGCACCTG[C/T]AACAGGTACTAGAAAACAGATGGGATAATATCTGACTAAAATTCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109594 Nonsense 761 1017 19 25
Genomic Location (Zv9):
Chromosome 7 (position 22047587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20637963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCCTCAACCTCCTGGATGTCCAGCAGGAGGCTGACAGAATGCACAAA[C/T]AACAGCACAGAGTCCAGCAGCAGAGGGTAAGACACACATACATACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link