ifi35

Ensembl ID:
ENSDARG00000075643
ZFIN ID:
ZDB-GENE-100311-2
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7E2G0]
Human Orthologue:
IFI35
Human Description:
interferon-induced protein 35 [Source:HGNC Symbol;Acc:5399]
Mouse Orthologue:
Ifi35
Mouse Description:
interferon-induced protein 35 Gene [Source:MGI Symbol;Acc:MGI:1917360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26077 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113889 Nonsense 90 388 4 10
Genomic Location (Zv9):
Chromosome 3 (position 30093881)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29811920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCGAGCTGAGGAGCAGAAAGAGTCAAATGAGAATGAAAACAAGAAG[C/T]GAAGTAAAAAAATTCAGTCTGAGAAGGTCTGTTTTATTAAATATAGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link