rad9b

Ensembl ID:
ENSDARG00000075632
ZFIN ID:
ZDB-GENE-040910-3
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8WGD2]
Human Orthologue:
RAD9B
Human Description:
RAD9 homolog B (S. pombe) [Source:HGNC Symbol;Acc:21700]
Mouse Orthologue:
Rad9b
Mouse Description:
RAD9 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2385231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10079 Nonsense Available for shipment Available now
sa5464 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109222 Nonsense 59 326 3 9
ENSDART00000133519 Nonsense 135 402 5 11
ENSDART00000141728 None None 60 None 3

The following transcripts of ENSDARG00000075632 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 4628249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGAATCACCAAGACCCATAATTTGGGGTATCAGGAGTGTGAAGCTTTA[C/T]AGGCTGTGTTTCCRGCTCACCTCAGTCCAAAYGTCCTGATGGCCCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109222 Nonsense 107 326 4 9
ENSDART00000133519 Nonsense 183 402 6 11
ENSDART00000141728 None None 60 None 3

The following transcripts of ENSDARG00000075632 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 4626207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTCACTCTTTCCGTTTCCTCTCTTAAAKTCGTCCTGAAGACCTTTTG[T/A]GTGGAAGAAAATGGTGAGAAAACCTTTGCCTATGTTTCCAGTACANNNNNNNNGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/titoosrc