NP_001170963.1

Ensembl ID:
ENSDARG00000075631
Description:
putative pa014 protein-like [Source:RefSeq peptide;Acc:NP_001170963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7257 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112244 Essential Splice Site 14 43 1 2
Genomic Location (Zv9):
Chromosome 24 (position 20827014)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20074143
KASP Assay ID:
554-4440.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAGACATGCTGTACTGCTGTCCATGTTGTCTGCATTCAGATCCAGG[T/G]ATTGAGGRGGAGAGAAGTCCTCATTTAGTGTTTATATAAACATGATTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link