LOC565583

Ensembl ID:
ENSDARG00000075629
Human Orthologue:
IFI30
Human Description:
interferon, gamma-inducible protein 30 [Source:HGNC Symbol;Acc:5398]
Mouse Orthologue:
Ifi30
Mouse Description:
interferon gamma inducible protein 30 Gene [Source:MGI Symbol;Acc:MGI:2137648]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12419 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110683 Nonsense 17 253 2 8
Genomic Location:
Chromosome 11 (position 7501871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTAGTGCTTTTTGTGTTTCATGTATTATTTCTTGGAGTTCATAAAATA[C/T]AGTGTAAATCTCACCCAAAGCCTTCATGTGGATACYCTCCATCCCAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/veqt9pbs