lrig1

Ensembl ID:
ENSDARG00000075625
ZFIN ID:
ZDB-GENE-031113-23
Human Orthologue:
LRIG1
Human Description:
leucine-rich repeats and immunoglobulin-like domains 1 [Source:HGNC Symbol;Acc:17360]
Mouse Orthologue:
Lrig1
Mouse Description:
leucine-rich repeats and immunoglobulin-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:107935]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2115 Nonsense Confirmed mutation in F2 line Unknown
sa21875 Nonsense Mutation detected in F1 DNA During 2014
sa21876 Nonsense Mutation detected in F1 DNA During 2014
sa21874 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17507 Essential Splice Site Available for shipment Available now
sa21873 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu2115
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Nonsense 209 1022 6 18
Genomic Location:
Chromosome 11 (position 16743620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTTTTGCTCATTTTATTTACTTTATTTCTGTGTTTTGTAGGGAGT[T/A]GAGTAGGAACAGGTTGCGGTTGATCGAGGGACTCACCTTCCAAGGTTTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Nonsense 259 1022 7 18
ENSDART00000115085 Nonsense 259 1022 7 18
Genomic Location:
Chromosome 11 (position 16743336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTGCTCATTGTAAAGTTTTTCACATTTTTTTGTAGGCACCTGGACTA[T/G]AACAGTCTACGAGAAGTGAACAGTGGCTCTCTGTATGGTCTGGAGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Nonsense 259 1022 7 18
ENSDART00000115085 Nonsense 259 1022 7 18
Genomic Location:
Chromosome 11 (position 16743336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTGCTCATTGTAAAGTTTTTCACATTTTTTTGTAGGCACCTGGACTA[T/G]AACAGTCTACGAGAAGTGAACAGTGGCTCTCTGTATGGTCTGGAGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Essential Splice Site 426 1022 11 18
Genomic Location:
Chromosome 11 (position 16731071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCATCCAACCCGAGGCATTCAGCAAGATGAAGAACCTGCGCTACCTG[T/C]GAGTCTCAGTAAACCTTTTCACATGCACACACTCGTCATCCGATCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Essential Splice Site 426 1022 12 18
Genomic Location:
Chromosome 11 (position 16730581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAATCAAATAATTTGCATTAGGTTGAAGTTTTTACTGATTTCTCTGCA[G/A]TCATATTCAGAGCGACAGTTTTCTGTGTGACTGTCAGCTGCACTGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115085 Nonsense 620 1022 14 18
Genomic Location:
Chromosome 11 (position 16726179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCACCAAAGCGCGGTTGGAGTGTGCGGCCGAAGGGCATCCGACTCCA[C/T]AGGTGGCATGGCAGAAAGATGGCGGAACAGACTTCCCTGCTGCCCGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0e53jz9l