ercc6

Ensembl ID:
ENSDARG00000075612
ZFIN ID:
ZDB-GENE-070228-1
Description:
Novel protein similar to H.sapiens ERCC6, excision repair cross-complementing rodent repair deficien
Mouse Orthologue:
Ercc6
Mouse Description:
excision repair cross-complementing rodent repair deficiency, complementation group 6 Gene [Source:M

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22329 Nonsense Available for shipment Available now
sa22330 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1301 Nonsense Available for shipment Available now
sa35517 Nonsense Mutation detected in F1 DNA During 2016
sa2690 Nonsense F2 line generated During 2016
sa22331 Nonsense Mutation detected in F1 DNA During 2016
sa35518 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Nonsense 88 1390 1 19
ENSDART00000134027 Nonsense 88 204 2 4
ENSDART00000134809   None 560 None 12
Genomic Location:
Chromosome 13 (position 31098963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCACAGCTCTCAGGCCGCTGAGCTCCAAGGTCTGGGTGTGGATGTTTA[C/A]GACCAAGATGTCCTGGAGCAGGGTGTGTTGCAGCAGGTGGACAGAGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Essential Splice Site 129 1390 2 19
ENSDART00000134027 Essential Splice Site 129 204 3 4
ENSDART00000134809   None 560 None 12
Genomic Location:
Chromosome 13 (position 31099201)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATTTGAGGTTGATCTACAGTAATGTGGTTGGTTTGTAAAACATTTC[A/T]GGTCATGTACAAGTGCTTTGAAACACATCAACAAAATATTGGAGCAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Nonsense 180 1390 3 19
ENSDART00000134027 Nonsense 179 204 4 4
ENSDART00000134809   None 560 None 12
Genomic Location:
Chromosome 13 (position 31100139)
KASP Assay ID:
554-1216.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTGTTATCCTTTTACAGGAGAAGCAGTTAAAAAAGATCAGAGCCAAG[C/T]AGAAGAGATTGCAAGCTCTTCTTGACGGAGAGGATATACAGAAGCTTGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Nonsense 193 1390 3 19
ENSDART00000134027 Nonsense 192 204 4 4
ENSDART00000134809   None 560 None 12
Genomic Location:
Chromosome 13 (position 31100178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGCCAAGCAGAAGAGATTGCAAGCTCTTCTTGACGGAGAGGATATA[C/T]AGAAGCTTGAGGCAGAATTATTGATTGAGGATGACGAGGGTAAGTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2690
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Nonsense 496 1390 6 19
ENSDART00000134027   None 204 None 4
ENSDART00000134809 Nonsense 55 560 2 12
Genomic Location:
Chromosome 13 (position 31107314)
KASP Assay ID:
554-2791.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTGCTTTTGTTGTCCAGGTATCAACAGACAGGTGTCAGGTGGATGTG[G/A]GAACTGCACTGCCAGCAAGCAGGAGGCATTCTGGGAGACGAGATGGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Nonsense 619 1390 8 19
ENSDART00000134027   None 204 None 4
ENSDART00000134809 Nonsense 178 560 4 12
Genomic Location:
Chromosome 13 (position 31116210)
KASP Assay ID:
2260-6564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATACATACGCATTATGCAAGATTACATCCAGAGATACGACTGGCATTA[T/A]GTCATCCTGGATGAGGGCCACAAGATAAGGAACCCAAATGCTGGGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112380 Splice Site, Nonsense 641 1390 8 19
ENSDART00000134027   None 204 None 4
ENSDART00000134809 Splice Site, Nonsense 200 560 4 12
Genomic Location:
Chromosome 13 (position 31116274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCACAAGATAAGGAACCCAAATGCTGGGGTCACTACAGCATGCAAG[C/T]AGGTGATCATTTCTTTTCCTTCTATTCTTTTTTTACTCTGTAAAAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link