cdc25d

Ensembl ID:
ENSDARG00000075599
ZFIN ID:
ZDB-GENE-090313-74
Description:
cell division cycle 25 homolog d [Source:RefSeq peptide;Acc:NP_001128154]
Human Orthologues:
CDC25A, CDC25B, CDC25C
Human Descriptions:
cell division cycle 25 homolog A (S. pombe) [Source:HGNC Symbol;Acc:1725]
cell division cycle 25 homolog B (S. pombe) [Source:HGNC Symbol;Acc:1726]
cell division cycle 25 homolog C (S. pombe) [Source:HGNC Symbol;Acc:1727]
Mouse Orthologues:
Cdc25a, Cdc25b, Cdc25c
Mouse Descriptions:
cell division cycle 25 homolog A (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:103198]
cell division cycle 25 homolog B (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:99701]
cell division cycle 25 homolog C (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:88350]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39707 Nonsense Mutation detected in F1 DNA During 2017
sa30807 Nonsense Mutation detected in F1 DNA During 2017
sa39706 Nonsense Mutation detected in F1 DNA During 2017
sa31237 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109089 Nonsense 159 387 7 12
ENSDART00000109089 Nonsense 159 387 7 12
Genomic Location (Zv9):
Chromosome 1 (position 55268962)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54051901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATTCTCTACCTGTCAATCACTTTGCAGGCCGCTGTGAGATTCCGT[C/T]AGCTGATGTCACAGCTGCAAGCCCCGCCCACACCTGTCACTCAGGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109089 Nonsense 159 387 7 12
ENSDART00000109089 Nonsense 159 387 7 12
Genomic Location (Zv9):
Chromosome 1 (position 55268962)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54051901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATTCTCTACCTGTCAATCACTTTGCAGGCCGCTGTGAGATTCCGT[C/T]AGCTGATGTCACAGCTGCAAGCCCCGCCCACACCTGTCACTCAGGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109089 Nonsense 369 387 12 12
Genomic Location (Zv9):
Chromosome 1 (position 55260965)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54043904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGCGCCAGCGCGAATACAGGGAACAACTGAACAGCTTCCTCAGGAGA[A/T]GACAAACACGACAGCGCAGACGACGGCCAATCAGAAGACATCACAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109089 Nonsense 376 387 12 12
Genomic Location (Zv9):
Chromosome 1 (position 55260944)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54043883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAACAACTGAACAGCTTCCTCAGGAGAAGACAAACACGACAGCGCAGA[C/T]GACGGCCAATCAGAAGACATCACAGAACAAAACGATAAACATTCTGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link