scpp6

Ensembl ID:
ENSDARG00000075598
ZFIN ID:
ZDB-GENE-090313-258
Description:
secretory calcium-binding phosphoprotein 6 [Source:RefSeq peptide;Acc:NP_001138709]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32734 Nonsense Mutation detected in F1 DNA During 2017
sa11763 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108933 Nonsense 72 345 3 8
ENSDART00000121605 Nonsense 76 302 2 7
Genomic Location (Zv9):
Chromosome 1 (position 44313682)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43229998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGGCCTCTCAACCCAACCCCAGTACTGCTGTCAGACAGCATCCAGCA[C/T]AGTTTCAGTACCTTCCTTATTCTCAGCAACCGCAGGTTAGAAATGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108933 Nonsense 129 345 5 8
ENSDART00000121605 Nonsense 133 302 4 7
Genomic Location (Zv9):
Chromosome 1 (position 44310844)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43227160
KASP Assay ID:
2259-0915.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAATATCCTGCTAATGCAGCTCCAGCTTTACGGCCAGCAAGACCACAA[C/T]AGGGGMAAAATGCWCACCAAATGCGTCAGCCTCAACAACAACAACAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link