flrt1b

Ensembl ID:
ENSDARG00000075597
ZFIN ID:
ZDB-GENE-080327-6
Description:
cDNA, clone cssl:d0318 [Source:UniProtKB/TrEMBL;Acc:A8BAV0]
Human Orthologue:
FLRT1
Human Description:
fibronectin leucine rich transmembrane protein 1 [Source:HGNC Symbol;Acc:3760]
Mouse Orthologue:
Flrt1
Mouse Description:
fibronectin leucine rich transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:3026647]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3283 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3283
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114790 Nonsense 83 696 2 2
Genomic Location:
Chromosome 14 (position 48861162)
KASP Assay ID:
554-0140.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAACAACCGCATAGACAATGCTGGGCTACCGACATCTTTAGAGCGA[C/T]GACTGACTGTGAGAGTAGTTTACCTCTATGATAATGAACTTGACGATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r07se1ql