LOC100334729

Ensembl ID:
ENSDARG00000075596
Human Orthologue:
RAB11FIP2
Human Description:
RAB11 family interacting protein 2 (class I) [Source:HGNC Symbol;Acc:29152]
Mouse Orthologue:
Rab11fip2
Mouse Description:
RAB11 family interacting protein 2 (class I) Gene [Source:MGI Symbol;Acc:MGI:1922248]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28093 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112620 Nonsense 133 483 2 7
Genomic Location (Zv9):
Chromosome 13 (position 19757860)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19498388
KASP Assay ID:
2260-6273.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCAGCTGGTACACTCTAGACTCACGGCCTGGTAAGAAGAGAAAAGAC[A/T]GAGGGAAGATTCAAGTTAGCATCCAGTTCATGCGGAACAACATGACCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link