TRIM71

Ensembl ID:
ENSDARG00000075593
Description:
tripartite motif-containing 71 [Source:HGNC Symbol;Acc:32669]
Human Orthologue:
TRIM71
Human Description:
tripartite motif-containing 71 [Source:HGNC Symbol;Acc:32669]
Mouse Orthologue:
Trim71
Mouse Description:
tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42659 Nonsense Mutation detected in F1 DNA During 2016
sa25002 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113483 Nonsense 89 824 1 5
Genomic Location (Zv9):
Chromosome 16 (position 9011976)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7875108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCCTGGAGGGCCAGCGGAGCCCCGGCGACCCCCTGAAGCTCAGATG[C/A]CCCACATGCGACCAAAAGGTGTCTCTGTCGGAGTCGGGCGTGGACGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113483 Nonsense 726 824 4 5
Genomic Location (Zv9):
Chromosome 16 (position 8966833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7830087
KASP Assay ID:
554-7329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCTTCAATCAGGAAGGTCACCTTGTTGTGACTGACTTCAACAATCAT[C/T]GACTGCTCGTCATCAGGCCTGACTGCCAGTCTGCACGCTTCCTTGGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link