ITFG1

Ensembl ID:
ENSDARG00000075584
Description:
integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
Human Orthologue:
ITFG1
Human Description:
integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
Mouse Orthologue:
Itfg1
Mouse Description:
integrin alpha FG-GAP repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:106419]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11345 Nonsense Available for shipment Available now
sa14935 Nonsense Available for shipment Available now
sa14164 Essential Splice Site Available for shipment Available now
sa8280 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 266 599 9 19
Genomic Location:
Chromosome 7 (position 43395405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCCCCCTCAGACGGTGATGGCTTCCAGGACCACCTGTTGCCGGTSTG[T/A]ATGGACGATGYGTGTGCTAAAAGTGCAATATACCTGGCCAGGCCTGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 408 599 12 19
Genomic Location:
Chromosome 7 (position 43458527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTTGCAGGGWATATTAGATATGATCGTGCTCAGCAAGGTGGAAGGG[A/T]AAGAAGAACTCGTCATCCACGCTTTGAAGAACAACTTTGAGGCCGACGCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Essential Splice Site 431 599 12 19
Genomic Location:
Chromosome 7 (position 43458598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTGAAGAACAACTTTGAGGCCGACGCRTATTTCGTGAAAGTCATCGG[T/G]GAGTATTAGATGTGTGKCATTTAGTAGTGATGGGTAATGTCTTATCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 463 599 14 19
Genomic Location:
Chromosome 7 (position 43494860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGGTGTGAAMCAGCCWGGCCCGTATGTCATGTACACATCGGTGGACT[C/A]GAACGGTTATCTAAAGAACGCTTCTGGTGAGTACACGGCTCAGAAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z7mck5ii