lrch2

Ensembl ID:
ENSDARG00000075580
ZFIN ID:
ZDB-GENE-080114-1
Description:
Novel protein similar to human and mouse leucine-rich repeats and calponin homology (CH) domain cont
Human Orthologue:
LRCH2
Human Description:
leucine-rich repeats and calponin homology (CH) domain containing 2 [Source:HGNC Symbol;Acc:29292]
Mouse Orthologue:
Lrch2
Mouse Description:
leucine-rich repeats and calponin homology (CH) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20480 Nonsense Mutation detected in F1 DNA During 2014
sa10513 Nonsense Available for shipment Available now
sa12170 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112312 Nonsense 288 742 6 21
Genomic Location:
Chromosome 5 (position 38799237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATAAAAAGCCTGACACACTTGACCTGCCTTCTCTGGGAAAACGCTG[T/A]TTACCTCAGCAGCTGACTGACAGGTCCATACAGCCTTTTGCCATCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112312 Nonsense 394 742 10 21
Genomic Location:
Chromosome 5 (position 38789436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAAMCCAGCCTGTAAAAGATCTTCCCATCTCTCCTTCACAGGAGCTG[G/T]AGCGGGTCCTGAAAACACACCAAAGCAAAGACAAAGAGAACTGGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112312 Essential Splice Site 632 742 19 21
Genomic Location:
Chromosome 5 (position 38734805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATGGCTAATTTGCAAATGAAACAAACAGAGCCCTTGTGTGTGTTTGC[A/T]GAACCTCGAGTCAAGGTTAAAGGKTTTAYTGCCAGATGACGTGGGCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h29c7mlk