LOC557383

Ensembl ID:
ENSDARG00000075571
Human Orthologue:
BICD2
Human Description:
bicaudal D homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17208]
Mouse Orthologue:
Bicd2
Mouse Description:
bicaudal D homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924145]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5846 Nonsense Mutation detected in F1 DNA During 2014
sa12439 Nonsense Available for shipment Available now
sa1692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 267 836 4 8
Genomic Location:
Chromosome 11 (position 37914769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGGAGCAGAAAGCAGCCCTTCGGAAAGARCTGACGCATCACATGACCT[T/A]GGGAGACTCCCTTCTCGCCAGCTCATTGGACGGACTCAAATTGAGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 303 836 4 8
Genomic Location:
Chromosome 11 (position 37914878)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAATGAMGATGCCATTCTGACTCTTGAAAACGGATTTGCTAAAGTCTG[T/A]GAAGRTAATGATGAAGATAACAGATTGTCTTCACCCAAGAGAGATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 663 836 6 8
Genomic Location:
Chromosome 11 (position 37921101)
KASP Assay ID:
554-1638.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGGAGGAGATTTTGAAGCTCAAGTCCTTRCTGAGCACCAAGCGTGAA[C/T]AGATTGCCACRCTCAGGACTGTGCTCAAGGCCAACAAGCAGGTGAGAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ceqgknq0