LOC557383

Ensembl ID:
ENSDARG00000075571
Human Orthologue:
BICD2
Human Description:
bicaudal D homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17208]
Mouse Orthologue:
Bicd2
Mouse Description:
bicaudal D homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924145]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35141 Nonsense Mutation detected in F1 DNA During 2016
sa5846 Nonsense Mutation detected in F1 DNA During 2016
sa12439 Nonsense Available for shipment Available now
sa41891 Nonsense Mutation detected in F1 DNA During 2016
sa1692 Nonsense Available for shipment Available now
sa38858 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 127 836 2 8
Genomic Location (Zv9):
Chromosome 11 (position 37910186)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36802673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGCGTACTATGAGCAGAGGGTGCAGGAGCTGCAGTCGGACCTACGA[C/T]AAGCTAAAAACACCCTCACCGGCACCCAGGCGGAGAACGAGCGCCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 267 836 4 8
Genomic Location (Zv9):
Chromosome 11 (position 37914769)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36807256
KASP Assay ID:
554-3861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGGAGCAGAAAGCAGCCCTTCGGAAAGARCTGACGCATCACATGACCT[T/A]GGGAGACTCCCTTCTCGCCAGCTCATTGGACGGACTCAAATTGAGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 303 836 4 8
Genomic Location (Zv9):
Chromosome 11 (position 37914878)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36807365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAATGAMGATGCCATTCTGACTCTTGAAAACGGATTTGCTAAAGTCTG[T/A]GAAGRTAATGATGAAGATAACAGATTGTCTTCACCCAAGAGAGATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 332 836 4 8
Genomic Location (Zv9):
Chromosome 11 (position 37914964)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36807451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGAGATGAAAATTTCCGTCCCGCACCAAGTCTGGTAGATGACTTGT[T/A]GACCGAATTGAACATCTCTGAGATCCAGAAACTCAAGCAACAGCTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Nonsense 663 836 6 8
Genomic Location (Zv9):
Chromosome 11 (position 37921101)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36813588
KASP Assay ID:
554-1638.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGGAGGAGATTTTGAAGCTCAAGTCCTTRCTGAGCACCAAGCGTGAA[C/T]AGATTGCCACRCTCAGGACTGTGCTCAAGGCCAACAAGCAGGTGAGAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109235 Essential Splice Site 677 836 7 8
Genomic Location (Zv9):
Chromosome 11 (position 37921957)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36814444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAATGAATGGTCTTTCTGAACAGTGGTGTATGGTTGCTTTTCTTTC[A/G]GACAGCTGAGGTCGCCCTGGCAAACTTGAAGAGCAAATATGAGAATGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link