ide

Ensembl ID:
ENSDARG00000075570
ZFIN ID:
ZDB-GENE-070410-85
Description:
insulin-degrading enzyme [Source:RefSeq peptide;Acc:NP_001082994]
Human Orthologue:
IDE
Human Description:
insulin-degrading enzyme [Source:HGNC Symbol;Acc:5381]
Mouse Orthologue:
Ide
Mouse Description:
insulin degrading enzyme Gene [Source:MGI Symbol;Acc:MGI:96412]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42283 Nonsense Mutation detected in F1 DNA During 2016
sa35572 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28188 Nonsense Mutation detected in F1 DNA During 2016
sa15036 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113215 Nonsense 43 998 2 25
Genomic Location:
Chromosome 13 (position 42965062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGGTGGTGAGTGATATCATTCGCTCTCCAGAAGACAAACGGGAGTA[T/G]CGAGGACTCGAGTTTACAAATGGTCTGAAAGCCATTCTCATCAGTGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113215 Essential Splice Site 490 998 12 25
Genomic Location:
Chromosome 13 (position 42982210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGGCACACAGTATAAACAAGAAGCCATTACTGATGAAGCTATTAAGG[T/C]GAAGCGCGTTTGATTTTAGCAAATCTCTCTCTCTAGTATGTCATGGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113215 Nonsense 774 998 20 25
ENSDART00000113215 Nonsense 774 998 20 25
Genomic Location:
Chromosome 13 (position 42994103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAGCAGAGGAACGAGGTTCATAATAACTGTGGGATCGAGATTTACTA[T/G]CAGACTGACATGCAGAACACCCATGAGAACATGCTGCTGGAGCTCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113215 Nonsense 774 998 20 25
ENSDART00000113215 Nonsense 774 998 20 25
Genomic Location:
Chromosome 13 (position 42994103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCAGCAGAGRAACGAGGTTCATAATAACTGTGGGATCGAGATTTACTA[T/A]CAGACTGACATGCAGAACACCCATGAGAACATGCTGCTGGAGCTCTTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link