si:ch73-79d13.2

Ensembl ID:
ENSDARG00000075567
ZFIN ID:
ZDB-GENE-081031-27
Description:
Novel protein similar to H.sapiens FBXL20, F-box and leucine-rich repeat protein 20 (FBXL20) [Source
Human Orthologue:
FBXL20
Human Description:
F-box and leucine-rich repeat protein 20 [Source:HGNC Symbol;Acc:24679]
Mouse Orthologue:
Fbxl20
Mouse Description:
F-box and leucine-rich repeat protein 20 Gene [Source:MGI Symbol;Acc:MGI:1919444]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15339 Nonsense Available for shipment Available now
sa36765 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110398 Nonsense 34 436 2 15

The following transcripts of ENSDARG00000075567 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5464833)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4924144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATAATGATGAGGCTGTTATTAACAAGAAGCTGCCGAAGGAACTGCTGT[T/A]ACGGTTGGTGTGAAACCCTTKTAGTACTTYTCTGCTTCATTTCCACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110398 Nonsense 48 436 3 15

The following transcripts of ENSDARG00000075567 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5464634)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4923945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCTGCAGAATTTTCTCATTTCTGGATGTAGTCACACTTTGCCGCTG[T/A]GCTCAAGTCTCACGAGTAAGTGCCTTTTAAAAAAAAGTACATTTAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link