si:dkey-76k16.5

Ensembl ID:
ENSDARG00000075561
ZFIN ID:
ZDB-GENE-090313-330
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4D3]
Human Orthologues:
GLYAT, GLYATL1, GLYATL2, GLYATL3
Human Descriptions:
glycine-N-acyltransferase [Source:HGNC Symbol;Acc:13734]
glycine-N-acyltransferase-like 1 [Source:HGNC Symbol;Acc:30519]
glycine-N-acyltransferase-like 2 [Source:HGNC Symbol;Acc:24178]
glycine-N-acyltransferase-like 3 [Source:HGNC Symbol;Acc:21349]
Mouse Orthologues:
AC121932.1, Glyat, Gm4952, Keg1
Mouse Descriptions:
glycine N-acyltransferase-like protein 3 [Source:RefSeq peptide;Acc:NP_001138532]
glycine-N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:2147502]
kidney expressed gene 1 Gene [Source:MGI Symbol;Acc:MGI:1928492]
predicted gene 4952 Gene [Source:MGI Symbol;Acc:MGI:3643569]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22343 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112664 Essential Splice Site 25 282 None 7
ENSDART00000141631 Essential Splice Site 25 218 None 5
Genomic Location (Zv9):
Chromosome 13 (position 33892080)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33558060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGCCGAGACTTCTTTATACGCGCACCTGCCTAAAGCTATAAAGG[T/G]GAGTTGCTCATTATATTTTTCTTGTCACATTATTTATCGCCCATACTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link