mll3b

Ensembl ID:
ENSDARG00000075560
ZFIN ID:
ZDB-GENE-070705-340
Description:
Novel protein similar to human and mouse myeloid/lymphoid or mixed-lineage leukemia 3 (MLL3) [Source
Human Orthologue:
MLL3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 3 [Source:HGNC Symbol;Acc:13726]
Mouse Orthologue:
Mll3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5126 Essential Splice Site F2 line generated During 2014
sa3422 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11689 Nonsense Available for shipment Available now
sa19694 Nonsense Available for shipment Available now
sa5127 Nonsense F2 line generated During 2014
sa6827 Nonsense Mutation detected in F1 DNA During 2014
sa17591 Nonsense Available for shipment Available now
sa15663 Nonsense Available for shipment Available now
sa10821 Nonsense Available for shipment Available now
sa25101 Nonsense Mutation detected in F1 DNA During 2014
sa17423 Essential Splice Site Available for shipment Available now
sa1802 Missense F2 line generated During 2014
sa19695 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5126
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Essential Splice Site 204 4879 4 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12694384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGACCGGGGCTGCCAGCCAATCAGGGAGGCAAAGGGGCCTAGAGAG[G/A]TAAGCTGATTGGCTGGGGCAATTGAGTCTGTGACATATTATAATATGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Essential Splice Site 480 4879 None 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None 280 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12731205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTCCCGATATCCAAAAAGACTTGCTTTCATGCCATCAATGCAAAAGG[T/C]ACATATCCAGAGCAGATCTGCACTTTGAATTGAATTGTCAGCTGTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 551 4879 11 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12731553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGAATCAACACAACTAGWTCCATCAAATAATGATTCTGAGCCTGCC[A/T]AAGTTCAAGATATAGAAMCTCATCAGCCTGTTCGAGAGATGCAGAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 1586 4879 32 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 Nonsense 387 601 10 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12786865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTATCCACTGTGTATTGGTATGTTTTTTTATGCAGGATTGTCTTCA[C/T]GAATGCCAGTGATGAATGGTTTAATGGAATCCAAACAGCAGTTTTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5127
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 2488 4879 37 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12791782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCACCATATCCTGGCCCAGGAGCTGTAAGAGCACCTCAGAGATTCTA[T/A]GCGACAAGAGATAGACAAGGACAGTTTCCTGAAGGCCAGTTACCCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 2595 4879 38 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12792198)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCAACAGCATAACATCATGGGACAGCCTTTTATTGAACTGAGACAC[A/T]GAACACCAGATAGCAGACTTCGTCTTTCCTTTGGACCTCCTGGTATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 2931 4879 38 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12793206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCATGCTGGTCAGTGTACCACCAGAAGGTAAARAACTGAAGCAAGAA[C/T]AATGTGGAAAGTCAACAGAACAAAACAACCTTTCAAATCAGGAAACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 3375 4879 43 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12799359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACCCATTTAGCGAAGGCTTCCAGGAGCGAGAACGCAAGGAGAGAKTA[C/T]GAGAGCAGCAGGAGCGGCAAMGAATRCAGATCATAAAGGAGGTGGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 3437 4879 43 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12799545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCAGGAGCTACCRCAGGACTTCATGCAGCCACCCAGATTGCAGCAA[C/T]AGAWCCAAGGGCCCACWTTTCCACAGCAGCAAGGCACACAACAAGGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Nonsense 3582 4879 43 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12799982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACACCTCATACACCTCACTCAGACATGACTGCTCCATTAACACCCTG[C/A]GTGTCAGACACATCATCCACACCGACAAGGAACCCAATGGTCTTTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Essential Splice Site 3922 4879 46 60
ENSDART00000131780 None None 734 None 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 Essential Splice Site 208 383 4 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12802595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAGAGGAGCTTGCCAGAAAAGGTGGCCTCATTGCTGGACACGAWGG[T/C]GAGTAGYAGCTGATGTAGACTGAGCGGGTGATTTYGATCTATATTWGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1802
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Missense 4278 4879 53 60
ENSDART00000131780 Missense 133 734 3 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12812281)
KASP Assay ID:
554-1794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCTCCTGCTCCGTACCTCCACATGGCTTTTGCACCAGCSAAAGCAA[T/A]CAAGACAGAATCCAAACCTAGAAGCATATCAGAGGGCCATCTTAAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112279 Essential Splice Site 4603 4879 53 60
ENSDART00000131780 Essential Splice Site 458 734 3 10
ENSDART00000132574 None None 90 None 2
ENSDART00000133043 None None 383 None 8
ENSDART00000137621 None None 293 None 4
ENSDART00000143400 None None 279 None 6
ENSDART00000145384 None None 328 None 8
ENSDART00000146674 None None 601 None 13

The following transcripts of ENSDARG00000075560 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12813257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAGCAGGGATATGAGGATCTGGTTCTGACTGATACCTCTGCTAAAGG[T/C]ACATCGTCATTAGACTCTTTCCTAATTGTATTATGTTTGTTAATGACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bh3ao3pf