ppm1g

Ensembl ID:
ENSDARG00000075559
ZFIN ID:
ZDB-GENE-030425-4
Description:
protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform [Source:RefSeq peptide;Acc
Human Orthologue:
PPM1G
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1G [Source:HGNC Symbol;Acc:9278]
Mouse Orthologue:
Ppm1g
Mouse Description:
protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35411 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35412 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109665 Essential Splice Site 400 495 9 12
Genomic Location (Zv9):
Chromosome 13 (position 5877044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6071069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTGAATGCATTTTCATTATTGCATGACTAATGGCTGGGTTTCATGT[A/T]GGCGATCACTTTTACAAAAGAAACAAAGCTCTTCCCGCTGAGGAACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109665 Essential Splice Site 400 495 9 12
Genomic Location (Zv9):
Chromosome 13 (position 5877045)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6071070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGAATGCATTTTCATTATTGCATGACTAATGGCTGGGTTTCATGTA[G/T]GCGATCACTTTTACAAAAGAAACAAAGCTCTTCCCGCTGAGGAACAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link