LUZP1

Ensembl ID:
ENSDARG00000075556
Description:
leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]
Human Orthologue:
LUZP1
Human Description:
leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]
Mouse Orthologue:
Luzp1
Mouse Description:
leucine zipper protein 1 Gene [Source:MGI Symbol;Acc:MGI:107629]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23093 Nonsense Mutation detected in F1 DNA During 2014
sa9757 Nonsense Available for shipment Available now
sa23094 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 214 992 1 1
Genomic Location:
Chromosome 17 (position 28109407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAGGACGACAAAATCATACTCAGGTTGACTGAGAAGCTTGAACGT[C/T]AAAAAAATAAAGTAGGCACAACAGACCACAGCCGAACTGATTCTAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 406 992 1 1
Genomic Location:
Chromosome 17 (position 28109983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCGAACAAGTCACCTCCAAATACAAAAGCAGAGATTCCTCTCCTCAA[C/T]AGAGGCGAGAAACAAAGCTGAGGAACAAAGATCTTTGTCACTCCAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 626 992 1 1
Genomic Location:
Chromosome 17 (position 28110643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTGTCAAGTACAAGTGGAAGAACATCAAAGTACACTAGATACTCA[C/T]GACTACAAGATTCTTACTCTGATGCTTCCTCAAAGAGCCCCTTTAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5l6dtmi2