LUZP1

Ensembl ID:
ENSDARG00000075556
Description:
leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]
Human Orthologue:
LUZP1
Human Description:
leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]
Mouse Orthologue:
Luzp1
Mouse Description:
leucine zipper protein 1 Gene [Source:MGI Symbol;Acc:MGI:107629]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30696 Nonsense Mutation detected in F1 DNA During 2016
sa36432 Nonsense Available for shipment Available now
sa23093 Nonsense Available for shipment Available now
sa9757 Nonsense Available for shipment Available now
sa23094 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 36 992 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28108873)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28032800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGGATGAACTTGAAGAGGCCAAAGGCAAGTTACAGAAAGCTGAAGAT[G/T]AACTTCTTGACATTCAGGACAAAATCATACAGGCTGAGGGGAGTAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 69 992 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28108972)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28032899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATTGCTCACAGATGTGGAAACAATGCGAAAGAGATTACTCAAAATC[G/T]AAGGTAAAGATGAGGAGGTCAGGAAAGCAGAAGATCTTTGTCGTGAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 214 992 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28109407)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28033334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAGGACGACAAAATCATACTCAGGTTGACTGAGAAGCTTGAACGT[C/T]AAAAAAATAAAGTAGGCACAACAGACCACAGCCGAACTGATTCTAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 406 992 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28109983)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28033910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCGAACAAGTCACCTCCAAATACAAAAGCAGAGATTCCTCTCCTCAA[C/T]AGAGGCGAGAAACAAAGCTGAGGAACAAAGATCTTTGTCACTCCAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110280 Nonsense 626 992 1 1
Genomic Location (Zv9):
Chromosome 17 (position 28110643)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28034570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTGTCAAGTACAAGTGGAAGAACATCAAAGTACACTAGATACTCA[C/T]GACTACAAGATTCTTACTCTGATGCTTCCTCAAAGAGCCCCTTTAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link