ENSDARG00000075552

Ensembl ID:
ENSDARG00000075552
Human Orthologues:
BIRC6, UBE2Z
Human Descriptions:
baculoviral IAP repeat-containing 6 [Source:HGNC Symbol;Acc:13516]
ubiquitin-conjugating enzyme E2Z [Source:HGNC Symbol;Acc:25847]
Mouse Orthologues:
Birc6, Ube2z
Mouse Descriptions:
baculoviral IAP repeat-containing 6 Gene [Source:MGI Symbol;Acc:MGI:1276108]
ubiquitin-conjugating enzyme E2Z (putative) Gene [Source:MGI Symbol;Acc:MGI:1343160]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30421 Nonsense Mutation detected in F1 DNA During 2017
sa38173 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110636 Nonsense 72 230 3 6
Genomic Location (Zv9):
Chromosome Zv9_NA224 (position 2941)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16066775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTTTTGTGCTTCCTATAGCCCAGGTTCTTCAAGATCCAGCCATCTA[C/A]GGGGTGATTCAGTCAGGTGATCATAAAGCCAGAACATGTGCCGTCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110636 Nonsense 181 230 6 6
Genomic Location (Zv9):
Chromosome Zv9_NA224 (position 1708)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16065542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTTGTTCTTTCTATCCCAGCACTTGTATAATGTTGAGTCTGAAATT[G/T]AAGAAACATATTATGACTCTGCCGAGGGCAGCAGTAGTGGTGCCTCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link