si:ch211-274p24.3

Ensembl ID:
ENSDARG00000075551
ZFIN ID:
ZDB-GENE-091118-96
Human Orthologue:
AIFM3
Human Description:
apoptosis-inducing factor, mitochondrion-associated, 3 [Source:HGNC Symbol;Acc:26398]
Mouse Orthologue:
Aifm3
Mouse Description:
apoptosis-inducing factor, mitochondrion-associated 3 Gene [Source:MGI Symbol;Acc:MGI:1919418]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15498 Nonsense Available for shipment Available now
sa30725 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115097 Nonsense 114 543 5 19
ENSDART00000131717 Nonsense 83 512 3 17
Genomic Location (Zv9):
Chromosome 21 (position 38151650)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39271729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATCATGTTTCATCTTGACAGGTGAAAGTCGAAAACAACAAAGTGTA[T/A]GTRTCTGTAAAGAAAAGGGTAAAGTACTTTCATATGTGCATTTTATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115097 Nonsense 449 543 16 19
ENSDART00000131717 Nonsense 418 512 14 17
Genomic Location (Zv9):
Chromosome 21 (position 38141719)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39261798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACTGTGCTTTATTAGGAAGGATTGCAGCTCTCAACATGCTGTGCAGA[G/T]AAGTGGAGCTAAACACAGTGCCATACTACTGGACCGTCCTGTTCGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link