cdh5

Ensembl ID:
ENSDARG00000075549
ZFIN IDs:
ZDB-GENE-040816-1, ZDB-GENE-040816-1
Description:
cadherin-5 [Source:RefSeq peptide;Acc:NP_001003983]
Human Orthologues:
CDH1, CDH13, CDH15, CDH2, CDH26, CDH3, CDH4
Human Descriptions:
cadherin 1, type 1, E-cadherin (epithelial) [Source:HGNC Symbol;Acc:1748]
cadherin 13, H-cadherin (heart) [Source:HGNC Symbol;Acc:1753]
cadherin 15, type 1, M-cadherin (myotubule) [Source:HGNC Symbol;Acc:1754]
cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:1759]
cadherin 26 [Source:HGNC Symbol;Acc:15902]
cadherin 3, type 1, P-cadherin (placental) [Source:HGNC Symbol;Acc:1762]
cadherin 4, type 1, R-cadherin (retinal) [Source:HGNC Symbol;Acc:1763]
Mouse Orthologues:
Cdh1, Cdh13, Cdh15, Cdh2, Cdh26, Cdh3, Cdh4
Mouse Descriptions:
cadherin 1 Gene [Source:MGI Symbol;Acc:MGI:88354]
cadherin 13 Gene [Source:MGI Symbol;Acc:MGI:99551]
cadherin 15 Gene [Source:MGI Symbol;Acc:MGI:106672]
cadherin 2 Gene [Source:MGI Symbol;Acc:MGI:88355]
cadherin 3 Gene [Source:MGI Symbol;Acc:MGI:88356]
cadherin 4 Gene [Source:MGI Symbol;Acc:MGI:99218]
cadherin-like 26 Gene [Source:MGI Symbol;Acc:MGI:2685856]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21048 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10732 Nonsense Available for shipment Available now
sa21049 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3640 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7601 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 75 767 None 12
ENSDART00000111441 Essential Splice Site 75 767 None 13
Genomic Location:
Chromosome 7 (position 45444542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTATGAGGAAACACGACCTAAAAACCCACCTGAAAAGATTGGAAAGG[T/C]AGACGGTCTTGTAAACAAATGGATCACACTTTAATTTGGAGAGATCCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Nonsense 484 767 9 12
ENSDART00000111441 Nonsense 484 767 9 13
Genomic Location:
Chromosome 7 (position 45449312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAATGACAATGCACCAGAACTAACCAATGGGAGCTACGTGTATGTCTG[T/A]GAGAATGATAAACCTAACACAGTAAGGAGTTGTTCTAATGCATTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 492 767 10 12
ENSDART00000111441 Essential Splice Site 492 767 10 13
Genomic Location:
Chromosome 7 (position 45449424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACGATTGACCTTTAGAAAATATCTGTATTCATTCATTGCTCTCTTGCA[G/A]ATAATTGGGACTATTGGTGCCTCCGACAAGGATGAAAATTCAGGCAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 526 767 10 12
ENSDART00000111441 Essential Splice Site 526 767 10 13
Genomic Location:
Chromosome 7 (position 45449529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACTCTTGCAAGAAAGAGCTCAAACTTTTCCCTCTATGATAACCAAGG[T/C]GGGTTACTAAAGATCATTCACAGAGTGCTTATAAATTGTTACTATAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Missense 691 767 12 12
ENSDART00000111441 Missense 691 767 12 13
Genomic Location:
Chromosome 7 (position 45454844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATGGTMAAGAAACCTCCTGCTTGTAAGGGTGACATGGCCATGATGA[T/A]CGAGGTGAAGAAGGACGAGGCAGATCGTGATCGAGATGGCATTCCCTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7iozswwd