mmp17b

Ensembl ID:
ENSDARG00000075547
ZFIN ID:
ZDB-GENE-081107-17
Human Orthologue:
MMP17
Human Description:
matrix metallopeptidase 17 (membrane-inserted) [Source:HGNC Symbol;Acc:7163]
Mouse Orthologue:
Mmp17
Mouse Description:
matrix metallopeptidase 17 Gene [Source:MGI Symbol;Acc:MGI:1346076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2748 Nonsense F2 line generated During 2014
sa2760 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2748
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108791 Nonsense 546 613 11 11
ENSDART00000144588 Nonsense 452 482 11 11
Genomic Location:
Chromosome 14 (position 52554638)
KASP Assay ID:
554-2843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCGTCTTTCAGCCTCTGATTGGCTGGATTGCCCTCAGGRCTCCTCCTA[C/A]AGTTCCGCCGACATCTCTCTCATCTCGCAGTTTGGCCAAYAGGAGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2760
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108791 Nonsense 560 613 11 11
ENSDART00000144588 Nonsense 466 482 11 11
Genomic Location:
Chromosome 14 (position 52554598)
KASP Assay ID:
554-3042.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCTCCTCCTAMAGTTCCGCCGACATCTCTCTCATCTCGCAGTTTGGCCAA[C/T]AGGAGCTGCACGAACAGAAAAAGCAAACAATCATCAACCAGATCAGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o1j3azjt