si:ch211-10e2.6

Ensembl ID:
ENSDARG00000075543
ZFIN ID:
ZDB-GENE-030131-6320
Description:
Chromodomain-helicase-DNA-binding protein 8 [Source:UniProtKB/Swiss-Prot;Acc:B0R0I6]
Human Orthologue:
CHD8
Human Description:
chromodomain helicase DNA binding protein 8 [Source:HGNC Symbol;Acc:20153]
Mouse Orthologue:
Chd8
Mouse Description:
chromodomain helicase DNA binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1915022]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25869 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa19827 Nonsense Available for shipment Available now
sa19826 Nonsense Available for shipment Available now
sa32979 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31293 Nonsense Available for shipment Available now
sa38345 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942 Essential Splice Site 91 2221 None 39
ENSDART00000013676 Missense 92 2160 1 35
ENSDART00000131837   None 2231 None 36
Genomic Location (Zv9):
Chromosome 2 (position 37818217)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38133131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACTGCAAAACCTTCAAACTCAGCAGCTCAGCCAGATCCCCCATGAGG[T/C]CTCTGTTGCCTCTGCTCCCATTTCCATTCAGCCCTCCCTCTCGGTGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942   None 2221 None 39
ENSDART00000013676 Nonsense 223 2160 1 35
ENSDART00000131837   None 2231 None 36
Genomic Location (Zv9):
Chromosome 2 (position 37817825)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38132739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATGCGACATCTCCTGCGCAGGGGCAGGTCAAAGTTGGCACTGGAGTA[C/T]AAAGGCTGGTTCAAACTGCAAATGGCCCAATGAAACAGGTGTTACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942 Nonsense 1559 2221 28 39
ENSDART00000013676 Nonsense 1589 2160 28 35
ENSDART00000131837 Nonsense 1350 2231 24 36
Genomic Location (Zv9):
Chromosome 2 (position 37804136)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38119050
KASP Assay ID:
2259-2391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTTTTTCTGTCTTTTAGGGTTTTGCTGAGAGTACGTATGCTTTATTA[T/A]CTGAAGCAGGAGGTCATTGGAGAACATGCTGATTCTGTATTGAGTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942 Essential Splice Site 1614 2221 30 39
ENSDART00000013676 Essential Splice Site 1644 2160 30 35
ENSDART00000131837 Essential Splice Site 1405 2231 26 36
Genomic Location (Zv9):
Chromosome 2 (position 37802083)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38116997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGATGCTGATGACTGATGTGTTTTTCACTCTGTATCTTGTTATTTTC[A/T]GGATATGAGATGTACACCACCATGCGTGCAGACCCCTGCTTGTGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942 Nonsense 1756 2221 32 39
ENSDART00000013676 Nonsense 1786 2160 32 35
ENSDART00000131837 Nonsense 1547 2231 28 36
Genomic Location (Zv9):
Chromosome 2 (position 37801447)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38116361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTAAGATCGAGGCAGCAGAGAAGGGGGACCGTAGGCGAAGACGCTGC[G/T]AACAAGCTACCAAACTCAAAGAGATAGCCAGACAAGAGCGACAGCAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009942 Nonsense 1951 2221 35 39
ENSDART00000013676 Nonsense 2033 2160 34 35
ENSDART00000131837 Nonsense 1794 2231 30 36
Genomic Location (Zv9):
Chromosome 2 (position 37797875)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38112789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTGTCCGTCAGACTCTCCGGCCATGCTGCTCTCTCATTCTGACAGC[A/T]AAGTTGGCATTCAGGCTGGCTGGGTCTGGAAGAAGAGCAAAAACAACGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link