pigu

Ensembl ID:
ENSDARG00000075530
ZFIN ID:
ZDB-GENE-100629-1
Description:
phosphatidylinositol glycan anchor biosynthesis class U protein [Source:RefSeq peptide;Acc:NP_00117
Human Orthologue:
PIGU
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class U [Source:HGNC Symbol;Acc:15791]
Mouse Orthologue:
Pigu
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class U Gene [Source:MGI Symbol;Acc:MGI:3039607]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12720 Nonsense Available for shipment Available now
sa26828 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1831 Nonsense Available for shipment Available now
sa40791 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110441 Nonsense 71 435 3 12
Genomic Location (Zv9):
Chromosome 6 (position 50680465)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50729943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCATTTAACTGTMTTTTTAATGTCTTCCAGACACCCCTTATGATATA[C/A]CTCTTTCATTTTTTGGTTGACTATGCAGAGATTGTTTTTATGGTAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110441 Essential Splice Site 209 435 7 12
Genomic Location (Zv9):
Chromosome 6 (position 50673633)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50723111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTATCCTCTGACACTGTTTGCTCCTGCACTGCTGTTCTTCCTGCAG[G/A]TGGGAGTCTACATTCAGACTAGTGCAGATGACATGACACCTGTGTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110441 Nonsense 212 435 8 12
Genomic Location (Zv9):
Chromosome 6 (position 50673548)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50723026
KASP Assay ID:
554-1822.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYACCTGTGTCCAAACTCAAACGTCTCTCTGTTTCTTTCAGAGATTGTA[T/A]ATCCCAGTGAACCTAAGGAGGAGCAGCTTCTGGTTCTTCACTCTTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110441 Nonsense 376 435 11 12
Genomic Location (Zv9):
Chromosome 6 (position 50668857)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50718335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGCTGTTGGCATGCTCTGCGCTCTTCCCTGTACTCTGGCATCTATG[G/A]ATTTACGCTGGCAGTGCCAACTCTAATTTCTACTATGCCATCACGTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link