LOC559090

Ensembl ID:
ENSDARG00000075526
Human Orthologue:
PWWP2A
Human Description:
PWWP domain containing 2A [Source:HGNC Symbol;Acc:29406]
Mouse Orthologue:
Pwwp2a
Mouse Description:
PWWP domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1918052]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23966 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113852 Essential Splice Site 300 636 5 6
Genomic Location:
Chromosome 21 (position 28770117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTAGTGGGAACGCTAAGGCCATAACCAGGGCTGCTGCTTTTCAGGAA[G/A]CCCACCAGAAGGTCCACTTTACTCGGCGACTGCAGCAGATCAGTGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9qynlco