si:ch211-120k19.1

Ensembl ID:
ENSDARG00000075517
ZFIN ID:
ZDB-GENE-100922-282
Human Orthologue:
MPV17L
Human Description:
MPV17 mitochondrial membrane protein-like [Source:HGNC Symbol;Acc:26827]
Mouse Orthologue:
Mpv17l
Mouse Description:
Mpv17 transgene, kidney disease mutant-like Gene [Source:MGI Symbol;Acc:MGI:2135951]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12169 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111074 Essential Splice Site 183 231 3 4
ENSDART00000144015 Essential Splice Site 194 242 4 5
Genomic Location (Zv9):
Chromosome 16 (position 19035807)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17066130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGATCAAGTTCGACACAATAATTTAATATTTGYTTCTCTTTTCGGT[A/T]GACTGGTGTGGTTTACTGGTCAACAATGCAGGTACTTTATTAGTTCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link