ENSDARG00000075510

Ensembl ID:
ENSDARG00000075510
Human Orthologues:
GTF2IRD2, GTF2IRD2B
Human Descriptions:
GTF2I repeat domain containing 2 [Source:HGNC Symbol;Acc:30775]
GTF2I repeat domain containing 2B [Source:HGNC Symbol;Acc:33125]
Mouse Orthologue:
Gtf2ird2
Mouse Description:
GTF2I repeat domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2149780]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29808 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9827 Nonsense Available for shipment Available now
sa43864 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa29808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098919 Essential Splice Site 25 594 1 2
Genomic Location (Zv9):
Chromosome 22 (position 27349017)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26864491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAGGTTGATTCAGAGTGCAGGGTATTTAATCAAAAGTGGACAAGTG[A/C]TTATTTTTTTTGTTTAGTGCAAAGAAGTGGCTGTTTGTCTCATCTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098919 Nonsense 176 594 2 2
Genomic Location (Zv9):
Chromosome 22 (position 27348551)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26864025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATATGYCCAGCTGCAGGAGAAAGTGAAAGAATTTATTTATTTTGCTT[T/A]AGCTCTTGATGAGAGCAATGAMGTGCAGGACACGGCACWGCTGYTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098919 Nonsense 344 594 2 2
Genomic Location (Zv9):
Chromosome 22 (position 27348048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACGGAGATGTGCTTTACCATACTGAAGTCCGATGGTTAAGCCGTGGC[A/T]GAGTTGAGGCGTTTTTAAAGCTGCTACCCGAAATTAACGCCTTCTTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link