PTGFRN (2 of 2)

Ensembl ID:
ENSDARG00000075505
Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Human Orthologue:
PTGFRN
Human Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologue:
Ptgfrn
Mouse Description:
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39530 Nonsense Mutation detected in F1 DNA During 2017
sa38238 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110331 Nonsense 36 867 2 9
Genomic Location (Zv9):
Chromosome 1 (position 1705916)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1801336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCGGTCAGTTTCGGTGTCTGGGGGCCCTTTGCTCCGGGTGGAGGGC[C/T]AGCCACTGTCCATCCGCTGTGATGTGTCCGACTATGAGGGCCCCAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110331 Nonsense 82 867 2 9
Genomic Location (Zv9):
Chromosome 1 (position 1706054)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1801474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAACGTGATCTCCACATTCGATCCTGCATTCTCAGACCGCTCTCTA[C/T]AGGACCGCATAAAGACCGGCGACATTAGCATAGCACGACTTGCGGACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link