si:ch211-26b3.4

Ensembl ID:
ENSDARG00000075491
ZFIN ID:
ZDB-GENE-081104-60
Description:
Novel protein similar to vertebrate connector enhancer of kinase suppressor of Ras 2 (CNKSR2) [Sourc
Human Orthologue:
CNKSR2
Human Description:
connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
Mouse Orthologue:
Cnksr2
Mouse Description:
connector enhancer of kinase suppressor of Ras 2 Gene [Source:MGI Symbol;Acc:MGI:2661175]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18798 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6972 Nonsense Mutation detected in F1 DNA During 2017
sa9214 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111146 Essential Splice Site 22 1031 2 23
ENSDART00000132612   1 411 1 11
ENSDART00000134394   None 179 None 8
Genomic Location (Zv9):
Chromosome 5 (position 24708531)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22421403
KASP Assay ID:
2259-5711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTACGATCACATGATTGTGATTTTCTCTCCGTGTCTCTTTCTCTC[A/G]GGGCTGGATGACTGTTTGCTGCAGTATATGAGGACGTTTGAGCGGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111146 Nonsense 866 1031 22 23
ENSDART00000132612   None 411 None 11
ENSDART00000134394   None 179 None 8
Genomic Location (Zv9):
Chromosome 5 (position 24660040)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22372912
KASP Assay ID:
554-5341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACCGCAGCACTCGTACACACATGCACACGCATGGTACTCTGAGGCCA[C/T]GAACTCACCTYCATGAGGAAGATGAGGAAGAAGAGGAGGAGAAACATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111146 Essential Splice Site 957 1031 22 23
ENSDART00000132612   None 411 None 11
ENSDART00000134394   None 179 None 8
Genomic Location (Zv9):
Chromosome 5 (position 24659764)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22372636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACGAATGAGMGACTACACCGCATACGGGTTCTCCGCTCCACWCTCAAG[G/A]TACGCAGACTCAATRAGGAATATACACTCCTCTCACTAAAATGTGGAAKT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link