si:ch211-155i15.6

Ensembl ID:
ENSDARG00000075490
ZFIN ID:
ZDB-GENE-091117-35
Human Orthologue:
ABCA3
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 3 [Source:HGNC Symbol;Acc:33]
Mouse Orthologues:
Abca14, Abca15, Abca16, Abca17, Abca3
Mouse Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 14 Gene [Source:MGI Symbol;Acc:MGI:2388708]
ATP-binding cassette, sub-family A (ABC1), member 15 Gene [Source:MGI Symbol;Acc:MGI:2388709]
ATP-binding cassette, sub-family A (ABC1), member 16 Gene [Source:MGI Symbol;Acc:MGI:2388711]
ATP-binding cassette, sub-family A (ABC1), member 17 Gene [Source:MGI Symbol;Acc:MGI:3625331]
ATP-binding cassette, sub-family A (ABC1), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351617]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33105 Nonsense Mutation detected in F1 DNA During 2017
sa40008 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111777 Nonsense 776 1292 14 23
ENSDART00000132791 Nonsense 611 1127 11 20
Genomic Location (Zv9):
Chromosome 3 (position 12588348)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12527301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTAGCCCAAAACCACCTGGTGGATGTTCTGTTCTTGCTGCTTCTGTA[C/A]GGCTGGGCGGTGATTCCTCTCATGTACTTGATGAGTTTCCTGTTTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111777 Nonsense 981 1292 18 23
ENSDART00000132791 Nonsense 816 1127 15 20
Genomic Location (Zv9):
Chromosome 3 (position 12578505)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12537144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACTCAGGATCTGTGTTTGTCTCACTAGATGTATTCAGGTGGGCAGT[C/A]GCTGTTAGCAGTGGACCGTCTCTCATTGGCCGTTGGGAAGGGCGAGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link