si:ch211-267e7.3

Ensembl ID:
ENSDARG00000075487
ZFIN ID:
ZDB-GENE-070912-265

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39808 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa19725 Essential Splice Site Available for shipment Available now
sa38322 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Nonsense 100 963 3 18
ENSDART00000132959 Nonsense 92 299 3 8
ENSDART00000136373 Missense 17 204 1 6
ENSDART00000138913   None 158 None 2
ENSDART00000144534   None 395 None 8
Genomic Location (Zv9):
Chromosome 2 (position 20357128)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20929738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACCCAAAACATCAACAGTTCTTTCTGCATTGGACCTTCAAAACAGTA[T/A]CAGCTGTGCACAAATCAGGTACAACCTAATGCTTAAAGGCGTTTTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Essential Splice Site 189 963 5 18
ENSDART00000132959 Essential Splice Site 181 299 5 8
ENSDART00000136373 Essential Splice Site 71 204 2 6
ENSDART00000138913   None 158 None 2
ENSDART00000144534   None 395 None 8
Genomic Location (Zv9):
Chromosome 2 (position 20356357)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20928967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGGACGGCATTTACCAGGGGGTTTGCATTGAAGGCCAGTGTCAGG[T/G]GTGTCACCGTTGCAAAGTACACTGTCAAAAAAATGTTGGTTCTACGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Essential Splice Site 816 963 15 18
ENSDART00000132959   None 299 None 8
ENSDART00000136373   None 204 None 6
ENSDART00000138913   None 158 None 2
ENSDART00000144534 Essential Splice Site 248 395 5 8
Genomic Location (Zv9):
Chromosome 2 (position 20337758)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20910368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCGACAAAAACTGCCCCGCTCACTGGGTGGAGCAGGAGTGGGAACAGG[T/C]GAGATGCTCATTTACTATAAGCTGCAATTTATGAACAACACTCTAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link