ptpn20

Ensembl ID:
ENSDARG00000075459
ZFIN ID:
ZDB-GENE-090313-90
Description:
Novel protein similar to H.sapiens PTPN13, protein tyrosine phosphatase, non-receptor type 13 (APO-1
Human Orthologues:
PTPN20A, PTPN20B, PTPN20C
Human Descriptions:
protein tyrosine phosphatase, non-receptor type 20A [Source:HGNC Symbol;Acc:23422]
protein tyrosine phosphatase, non-receptor type 20B [Source:HGNC Symbol;Acc:23423]
protein tyrosine phosphatase, non-receptor type 20C [Source:HGNC Symbol;Acc:23424]
Mouse Orthologue:
Ptpn20
Mouse Description:
protein tyrosine phosphatase, non-receptor type 20 Gene [Source:MGI Symbol;Acc:MGI:1196295]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42229 Nonsense Mutation detected in F1 DNA During 2017
sa13082 Nonsense Available for shipment Available now
sa7227 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42230 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28137 Nonsense Mutation detected in F1 DNA During 2017
sa17079 Essential Splice Site Available for shipment Available now
sa17567 Essential Splice Site Available for shipment Available now
sa16981 Essential Splice Site Available for shipment Available now
sa35525 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Nonsense 664 1925 19 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31407531)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31053479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACATTCTATGTGACTTCAGTGATTTGACTGTAATCATCCGAAGCTA[C/T]AAGAACACCTTTGTGCACCAAAAATTGTAAATACGACTTTATTTGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Nonsense 692 1925 20 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31408064)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31054012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTAAAACAACTSTCAGTCAATATCTTCATGCTTTTTTTCATGAGTW[G/T]AGGATCTTCGGGGCAGCAAGACTTCACTGGCTCCAAGTAATTTAGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 765 1925 21 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31408328)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31054276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGTTAACTTCTKKAATGTATCAAAACTAAYCACTTTTTTAATKTGA[A/G]GACCYTCTTGGCAAAGCTTTGTTAATTTTTTTTTATTCTTCATCCTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 1030 1925 27 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936 Essential Splice Site 82 286 2 4
Genomic Location (Zv9):
Chromosome 13 (position 31416983)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31062931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCTGCAGACCTTCACAGGATGAGCATACAGATATTGAGACCTTTCTG[G/A]TAACATCCTCTTCCTTCATGTTTGCAAACAATTTTAAAATTTGACGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Nonsense 1161 1925 30 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31420319)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31066267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATGACGAAGAGGATGATGAAGATCCCAGAAGGGTGAAGCCTGATTG[T/A]ATTTCCTGTAGACATGTGGAATACTCTTTAATTAGAGATGCCTAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31420389)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31066337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAYTCTTTAATTAGAGATGCYTAATTTGTCTCTTAGTTTTTTTTTTTA[A/C]TCTAACTTTGGAGCAAGTAGRTTTTATAAGAGGTTGTTTAGAGAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31420389)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31066337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAYTCTTTAATTAGAGATGCYTAATTTGTCTCTTAGTTTTTTTTTTTA[A/C]TCTAACTTTGGAGCAAGTAGRTTTTATAAGAGGTTGTTTAGAGAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
ENSDART00000111705 Essential Splice Site 1167 1925 31 50
ENSDART00000132326   None 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31420389)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31066337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAYTCTTTAATTAGAGATGCYTAATTTGTCTCTTAGTTTTTTTTTTTA[A/C]TCTAACTTTGGAGCAAGTAGRTTTTATAAGAGGTTGTTTAGAGAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111705 Essential Splice Site 1673 1925 None 50
ENSDART00000132326 Essential Splice Site 287 373 None 10
ENSDART00000133774   None 205 None 4
ENSDART00000137664   None 94 None 3
ENSDART00000144568   None 128 None 3
ENSDART00000147085   None 89 None 3
ENSDART00000147936   None 286 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31437143)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31083091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGCCCTCGAGCAGCTAGAAAAGCAAGATCTGGTCAAAGAGTTTATGG[T/A]AAGTTCTGGTCAGCATCAGTATAATGTATATATAAAGCATATAGCACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link