LOC561737

Ensembl ID:
ENSDARG00000075456
Human Orthologue:
PIK3CA
Human Description:
phosphoinositide-3-kinase, catalytic, alpha polypeptide [Source:HGNC Symbol;Acc:8975]
Mouse Orthologue:
Pik3ca
Mouse Description:
phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:1206581]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16936 Nonsense Available for shipment Available now
sa35128 Nonsense Mutation detected in F1 DNA During 2016
sa35127 Nonsense Mutation detected in F1 DNA During 2016
sa35126 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114004 Nonsense 261 1071 3 19
Genomic Location (Zv9):
Chromosome 11 (position 35345902)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34246276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAATATMAGGGCAAATACATCCTGAAGGTCTGCGGCTGTGAMGAGTA[T/A]CTTTTGGAAAAGTACCCCATCAGTCAGTACAAGGTACGTTTAGGCCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114004 Nonsense 408 1071 6 19
Genomic Location (Zv9):
Chromosome 11 (position 35340226)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34240600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTACATTCCTGACATCCCCCGGGCGGCTCGTCTCTGTCTCTCCATCTG[T/A]TCTGTGAAAGGAAGGAAGGGGGCAAAAGAGGTGATAACGCTTTTCTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114004 Nonsense 514 1071 8 19
Genomic Location (Zv9):
Chromosome 11 (position 35338116)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34238490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACTGGATAATATCCAGAGAGATGGGATACAATTACTGCCAGTCTGGA[C/T]AGGTGAGCTTACAGACACACATCCTACTTAATTAATTATAGCGACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114004 Nonsense 722 1071 12 19
Genomic Location (Zv9):
Chromosome 11 (position 35333736)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34234110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGTGGAGGCCATGGAGAAGCTCATCAACCTCACAGACATTCTCAAA[C/T]AGGAGAAGAAGGATGAAACTCAGAAGGTAAACTCAGCACTCGACCTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link