LOC561737

Ensembl ID:
ENSDARG00000075456
Human Orthologue:
PIK3CA
Human Description:
phosphoinositide-3-kinase, catalytic, alpha polypeptide [Source:HGNC Symbol;Acc:8975]
Mouse Orthologue:
Pik3ca
Mouse Description:
phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:1206581]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114004 Nonsense 261 1071 3 19
Genomic Location:
Chromosome 11 (position 35345902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAATATMAGGGCAAATACATCCTGAAGGTCTGCGGCTGTGAMGAGTA[T/A]CTTTTGGAAAAGTACCCCATCAGTCAGTACAAGGTACGTTTAGGCCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pf6qpyk0