ENSDARG00000075451

Ensembl ID:
ENSDARG00000075451
Human Orthologue:
FKBP15
Human Description:
FK506 binding protein 15, 133kDa [Source:HGNC Symbol;Acc:23397]
Mouse Orthologue:
Fkbp15
Mouse Description:
FK506 binding protein 15 Gene [Source:MGI Symbol;Acc:MGI:2444782]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24809 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083443 Essential Splice Site 215 561 8 15
Genomic Location:
Chromosome Zv9_NA208 (position 14180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTAAAAATAAACAAAATTTAATTGTAAATGCCGTCTGTCTCTTTAA[G/T]GAACTAGTGATGTCACATCCTTCTTGATGACGGAGGCTCGACAACACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rl9hn44l