ENSDARG00000075451

Ensembl ID:
ENSDARG00000075451
Human Orthologue:
FKBP15
Human Description:
FK506 binding protein 15, 133kDa [Source:HGNC Symbol;Acc:23397]
Mouse Orthologue:
Fkbp15
Mouse Description:
FK506 binding protein 15 Gene [Source:MGI Symbol;Acc:MGI:2444782]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30487 Nonsense Mutation detected in F1 DNA During 2016
sa24809 Essential Splice Site Available for shipment Available now
sa39509 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083443 Nonsense 108 561 4 15
Genomic Location (Zv9):
Chromosome Zv9_NA208 (position 20836)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52593902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGTGTTCAGACATGTTTTCTGTTGCGTTTCAGAATCCTGATGCCACT[A/T]AAGCTAAGCTGATCTCTCGGATGGCTAAAATGGGTCAACCGATGCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083443 Essential Splice Site 215 561 8 15
Genomic Location (Zv9):
Chromosome Zv9_NA208 (position 14180)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52586897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTAAAAATAAACAAAATTTAATTGTAAATGCCGTCTGTCTCTTTAA[G/T]GAACTAGTGATGTCACATCCTTCTTGATGACGGAGGCTCGACAACACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083443 Nonsense 453 561 13 15
Genomic Location (Zv9):
Chromosome Zv9_NA208 (position 6066)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52578509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGGAGGAAGAGCTGCAGGACATGAAGACAGAGAAGGACAGTCTGGAG[C/T]GAGTGAGTTCATCTTGTTCTGTGGATATGTATATATGGTCTCTCCATCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link