si:ch73-149o12.1

Ensembl ID:
ENSDARG00000075446
ZFIN ID:
ZDB-GENE-041111-190
Human Orthologue:
NAA25
Human Description:
N(alpha)-acetyltransferase 25, NatB auxiliary subunit [Source:HGNC Symbol;Acc:25783]
Mouse Orthologue:
Naa25
Mouse Description:
N(alpha)-acetyltransferase 25, NatB auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:2442563]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41574 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34814 Essential Splice Site Available for shipment Available now
sa21640 Nonsense Available for shipment Available now
sa38772 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 20 975 1 24
Genomic Location (Zv9):
Chromosome 10 (position 3401699)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3393893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGCCATGTGCAAGACCCTAACGACAGGAGGCTACGACCTATCTACGG[T/A]AAGATAAAAACCGCACCGTGGGGCTGATGGAGACCCTGCTGGTCTCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 95 975 3 24
Genomic Location (Zv9):
Chromosome 10 (position 3393533)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3385727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAACTCTCTACAGGCACTGACCATCCTCTACAGAGAGATGCACCGACG[T/G]AAGTGATCACGGACCATCAAGGCATGTTTTGCATTGTATAACAGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Nonsense 550 975 15 24
Genomic Location (Zv9):
Chromosome 10 (position 3379678)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3371872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTAAATATTATCCATTCTGTGTTTCCAGGTATTTATTGACCCGCTA[T/A]GCAGAGTCTTTGGGCCAGTTTGCTGCTGCTTCCCAATCTTGTAACTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 577 975 15 24
Genomic Location (Zv9):
Chromosome 10 (position 3379595)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3371789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATCTTGTAACTTCTCCCTCAGGTTTTTTCACTCGAACCAGAAAGATG[T/A]ATGCTTATTTTCTGTTTTAAATGCTTTCATCTGTATGGCAAATCTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Nonsense 963 975 24 24
Genomic Location (Zv9):
Chromosome 10 (position 3373645)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3365839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGCAGAGCAGCTACCTGCGTTCGCTGCAAGAGATCGGGGAACTGT[T/A]GAAGAAGAGAGCGGACTCGTTGAAATCCCTCAAAATCTGAGCGCTCCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link