psmb5

Ensembl ID:
ENSDARG00000075445
ZFIN ID:
ZDB-GENE-990415-215
Description:
proteasome subunit beta type-5 [Source:RefSeq peptide;Acc:NP_571226]
Human Orthologue:
PSMB5
Human Description:
proteasome (prosome, macropain) subunit, beta type, 5 [Source:HGNC Symbol;Acc:9542]
Mouse Orthologue:
Psmb5
Mouse Description:
proteasome (prosome, macropain) subunit, beta type 5 Gene [Source:MGI Symbol;Acc:MGI:1194513]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25873 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13785 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113111 Essential Splice Site 175 269 3 3
Genomic Location (Zv9):
Chromosome 2 (position 38094559)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38409473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTGCTGATTGTCTCTCTTATGCTCTTCCTTCTTTTTTTCTGATTGC[A/T]GGACTCTACTATGTGGATTCAGAGGGCAACCGTGTATGCGGAGATTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113111 Nonsense 178 269 3 3
Genomic Location (Zv9):
Chromosome 2 (position 38094571)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38409485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGTCTCTCTTATGCTCTTCCTTCNTTTTTTCTGATTGCAGGACTCTACTA[T/A]GTGGATTCAGAGGGCAACCGTGTATGCGGAGAYYTGTTCGCTGTTGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link