A7MBS9_DANRE

Ensembl ID:
ENSDARG00000075436
Description:
Sytl2 protein [Source:UniProtKB/TrEMBL;Acc:A7MBS9]
Human Orthologue:
SYTL2
Human Description:
synaptotagmin-like 2 [Source:HGNC Symbol;Acc:15585]
Mouse Orthologue:
Sytl2
Mouse Description:
synaptotagmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1933366]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22619 Nonsense Available for shipment Available now
sa1715 Nonsense Available for shipment Available now
sa22620 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047643 Nonsense 337 1737 6 18
ENSDART00000114551 Nonsense 337 459 7 7
Genomic Location:
Chromosome 15 (position 18514496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTCTTCACCAATAAAGTTGCCCAAGTCACGTTTACCAGTGAGAGCCT[C/A]ATCACAACTGATAAACATGCCACAAGGGTTACAAGAGAAGCCAAAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047643 Nonsense 1178 1737 7 18
ENSDART00000114551 None None 459 None 7
Genomic Location:
Chromosome 15 (position 18517385)
KASP Assay ID:
554-1661.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGAAGCTAGCTATACCCTGCCAAAAACATCCCCAGAAATATCTTGG[A/T]GAGACAGAGACAAAAACAGTCAAAGAAGAACATCTCGTACCTCAGAAGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047643 Essential Splice Site 1688 1737 17 18
ENSDART00000114551 None None 459 None 7
Genomic Location:
Chromosome 15 (position 18527771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTAGCCAGTCACTCACTCGGAGGCCTGAGACTCGGCATGGGCACAG[G/A]TGCAGTCCAGTGTTAGGGTCTTCATCTGTTCAGAAAAACACATGGATAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a5o52f01