LOC558595

Ensembl ID:
ENSDARG00000075435
Human Orthologue:
AKAP11
Human Description:
A kinase (PRKA) anchor protein 11 [Source:HGNC Symbol;Acc:369]
Mouse Orthologue:
Akap11
Mouse Description:
A kinase (PRKA) anchor protein 11 Gene [Source:MGI Symbol;Acc:MGI:2684060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa511 Nonsense Available for shipment Available now
sa10049 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 793 1798 6 11
Genomic Location:
Chromosome 9 (position 18502758)
KASP Assay ID:
554-0231.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCAAGGTCATATCTCATGTACACAGCTCAGATGAACCTTCTCAGTA[T/G]AAACACAGTATTGATCATGTATGTCAGACCAGCCCTAAAAGAACCATATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 1611 1798 7 11
Genomic Location:
Chromosome 9 (position 18505344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGGGTGGCAATGTGACGGAGTCAACAGTGAGTCAGCAGCTCAGTT[T/A]GAGTGWTGGAGATGATAGTCTTGGGAGCTGGTCCAATCTGAGTTTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3l43x8vq