LOC558595

Ensembl ID:
ENSDARG00000075435
Human Orthologue:
AKAP11
Human Description:
A kinase (PRKA) anchor protein 11 [Source:HGNC Symbol;Acc:369]
Mouse Orthologue:
Akap11
Mouse Description:
A kinase (PRKA) anchor protein 11 Gene [Source:MGI Symbol;Acc:MGI:2684060]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41390 Nonsense Mutation detected in F1 DNA During 2016
sa511 Nonsense Available for shipment Available now
sa34605 Nonsense Mutation detected in F1 DNA During 2016
sa10049 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 169 1798 5 11
Genomic Location (Zv9):
Chromosome 9 (position 18500658)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17976728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAGGTATGCCCTGGAGTTACAGGTTCTGCACAGAGGCAATTCAGAAT[C/A]ATGTCAGGCTGAGGATGATGACACCAATCAGTCTGTCTCTTCTATCGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 793 1798 6 11
Genomic Location (Zv9):
Chromosome 9 (position 18502758)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17978828
KASP Assay ID:
554-0231.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCAAGGTCATATCTCATGTACACAGCTCAGATGAACCTTCTCAGTA[T/G]AAACACAGTATTGATCATGTATGTCAGACCAGCCCTAAAAGAACCATATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 1496 1798 6 11
Genomic Location (Zv9):
Chromosome 9 (position 18504865)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17980935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGAAACCTGTCGATATTGCCAAGGTCGAGATTGCTTGTTTTGCAGT[C/T]GAGATGGACGTCGCGGTTTTCAGGGTCTGAAAATAAGAAGGCAACAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108491 Nonsense 1611 1798 7 11
Genomic Location (Zv9):
Chromosome 9 (position 18505344)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17981414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGGGTGGCAATGTGACGGAGTCAACAGTGAGTCAGCAGCTCAGTT[T/A]GAGTGWTGGAGATGATAGTCTTGGGAGCTGGTCCAATCTGAGTTTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link