ENSDARG00000075433

Ensembl ID:
ENSDARG00000075433
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17101 Nonsense Available for shipment Available now
sa21858 Nonsense Mutation detected in F1 DNA During 2014
sa16728 Essential Splice Site Available for shipment Available now
sa5837 Nonsense Mutation detected in F1 DNA During 2014
sa9372 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 404 1366 11 33
Genomic Location:
Chromosome 11 (position 11346710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAACTAAGGACTGGGTCCAGTGCAATGACTCWCCTGTGAAAGTGTG[C/A]AAGCTGCCCGTCCACGGCCTGACYGACGGGGCWTCCTATCACTTCCGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 405 1366 11 33
Genomic Location:
Chromosome 11 (position 11346711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAACTAAGGACTGGGTCCAGTGCAATGACTCTCCTGTGAAAGTGTGC[A/T]AGCTGCCCGTCCACGGCCTGACCGACGGGGCATCCTATCACTTCCGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Essential Splice Site 654 1366 16 33
Genomic Location:
Chromosome 11 (position 11364684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGTAATGCACATCTTGTYTAAACTGATACTTTCTCTATTTGTCATC[A/T]GGTCCAGCATATGACATYAGTTTCTGGGAAGTGCGYGACACCTCCMTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 723 1366 17 33
Genomic Location:
Chromosome 11 (position 11364976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTACACTCATCTGTAGGTCACTGGACTTGAATCTGGAGCGTCATA[T/A]GTGTTCAGAGTMCGGGCTGTCAATGACAAAGGTGTTGGAAAAGCCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 1219 1366 33 33
Genomic Location:
Chromosome 11 (position 11381376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTCTGACWTGTACAGTGTGGGGTGACCCCAGCCCAGAGGTCACCTG[G/A]TTTAAGAATGAGCAGGAAGTGGTGTCCGACGACCGCTACAAGAKCACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fsrkwjjg