ENSDARG00000075433

Ensembl ID:
ENSDARG00000075433
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35034 Nonsense Mutation detected in F1 DNA During 2016
sa41789 Nonsense Mutation detected in F1 DNA During 2016
sa17101 Nonsense Available for shipment Available now
sa21858 Nonsense Mutation detected in F1 DNA During 2016
sa31817 Nonsense Mutation detected in F1 DNA During 2016
sa41790 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16728 Essential Splice Site Available for shipment Available now
sa35035 Nonsense Mutation detected in F1 DNA During 2016
sa5837 Nonsense Mutation detected in F1 DNA During 2016
sa41791 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35036 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9372 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 66 1366 3 33
ENSDART00000087105 Nonsense 66 1366 3 33
Genomic Location:
Chromosome 11 (position 11331246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAATGTGTATTTCTGTGTATTCAGGGCTCCTGAGGGCATGCAGGAGTA[T/A]CAGAGGATGGCGGCTCACTTTGGAAGAGATTTGGTTCAAATTCAACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 82 1366 3 33
Genomic Location:
Chromosome 11 (position 11331292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATCAGAGGATGGCGGCTCACTTTGGAAGAGATTTGGTTCAAATTCAA[C/T]AGGAGCTGCACAGGATGAAAGTGGCCACAAAGGAGCAAGTGCAGAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 404 1366 11 33
Genomic Location:
Chromosome 11 (position 11346710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAACTAAGGACTGGGTCCAGTGCAATGACTCWCCTGTGAAAGTGTG[C/A]AAGCTGCCCGTCCACGGCCTGACYGACGGGGCWTCCTATCACTTCCGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 405 1366 11 33
Genomic Location:
Chromosome 11 (position 11346711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAACTAAGGACTGGGTCCAGTGCAATGACTCTCCTGTGAAAGTGTGC[A/T]AGCTGCCCGTCCACGGCCTGACCGACGGGGCATCCTATCACTTCCGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 492 1366 12 33
Genomic Location:
Chromosome 11 (position 11355018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACATGCCACAAACCTCCTGGGTTACTATGTTGATGCCTCTGTGGTC[G/T]GATCCAAGGACTGGTTCCCCTGTAATCACAGGCCTTACAAACACACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Essential Splice Site 549 1366 13 33
Genomic Location:
Chromosome 11 (position 11358379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGGAGTCGCAGGAATCTGCTCCTCTCTTCATTGATGCTGCGCTTAG[T/A]AAGTGTACAACTTTGCTGACTTCTGTAGCAATGTCTCTGGAATGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Essential Splice Site 654 1366 16 33
Genomic Location:
Chromosome 11 (position 11364684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGTAATGCACATCTTGTYTAAACTGATACTTTCTCTATTTGTCATC[A/T]GGTCCAGCATATGACATYAGTTTCTGGGAAGTGCGYGACACCTCCMTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 710 1366 16 33
Genomic Location:
Chromosome 11 (position 11364855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGCTCATCAGATTTTGCCACAGTAAATGCTGAAAAAGTTGAACATTG[C/A]TTCCTGAAGGTATAGCACCAGAATTCCCAAAACAAACACAACACTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 723 1366 17 33
Genomic Location:
Chromosome 11 (position 11364976)
KASP Assay ID:
554-3660.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTACACTCATCTGTAGGTCACTGGACTTGAATCTGGAGCGTCATA[T/A]GTGTTCAGAGTMCGGGCTGTCAATGACAAAGGTGTTGGAAAAGCCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Essential Splice Site 840 1366 19 33
Genomic Location:
Chromosome 11 (position 11369425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACTGACACAGATGGAGTTTCATCCAGTTACTCTGTCAATGAAGAAG[G/A]TCAGAGATTTGGGTGTGAATTTCCCTTCCTTTGTTTACTTACAACGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Essential Splice Site 1175 1366 30 33
Genomic Location:
Chromosome 11 (position 11379446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTTCAACAGCATACACTGATGCCTATGCAGAATTCCAGAGACTGAA[G/A]TAAGAGAAAGTTCATTGTTAATTTTCAACACAATCATGATTCTTCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087105 Nonsense 1219 1366 33 33
Genomic Location:
Chromosome 11 (position 11381376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTCTGACWTGTACAGTGTGGGGTGACCCCAGCCCAGAGGTCACCTG[G/A]TTTAAGAATGAGCAGGAAGTGGTGTCCGACGACCGCTACAAGAKCACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link