DLG5 (4 of 4)

Ensembl ID:
ENSDARG00000075408
Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Human Orthologue:
DLG5
Human Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Mouse Orthologue:
Dlg5
Mouse Description:
discs, large homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918478]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31898 Nonsense Available for shipment Available now
sa12168 Essential Splice Site Available for shipment Available now
sa7368 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109315 Nonsense 18 1009 1 18
Genomic Location (Zv9):
Chromosome 12 (position 50328731)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48906543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTGAGCGCTTTGGGTTTTGATATCTCAGAGGGCGTGAGTGACCCGTA[T/A]CTCCCCGGGGATTATGGGATATTTGTGAGTAAAGTGGACAAAGGAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109315 Essential Splice Site 566 1009 10 18
Genomic Location (Zv9):
Chromosome 12 (position 50319856)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48915435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAANTAAAACACAATCARTAACAGAGTAACTGAGTCAGATCTGTGTTC[A/T]GGATCTCYGTCCCACTCCGACTGCAGCAGCCCCAGTCTCGTGACCCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109315 Missense 947 1009 17 18
Genomic Location (Zv9):
Chromosome 12 (position 50313637)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48922428
GRCz10 12 48932083
KASP Assay ID:
554-4225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTGGACGAAAACGCACAGAAGCTGATGCGTGGACACGTGCCCAGCA[A/T]GTGCATGTATGTGAGACTCATGGCATYAWTCCTGCTTCTGTTTCACTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link