ENSDARG00000075406

Ensembl ID:
ENSDARG00000075406
Human Orthologues:
PVR, PVRL1, PVRL2
Human Descriptions:
poliovirus receptor [Source:HGNC Symbol;Acc:9705]
poliovirus receptor-related 1 (herpesvirus entry mediator C) [Source:HGNC Symbol;Acc:9706]
poliovirus receptor-related 2 (herpesvirus entry mediator B) [Source:HGNC Symbol;Acc:9707]
Mouse Orthologues:
Pvr, Pvrl1, Pvrl2
Mouse Descriptions:
poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]
poliovirus receptor-related 1 Gene [Source:MGI Symbol;Acc:MGI:1926483]
poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39956 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113876 Splice Site, Nonsense 396 548 8 10
Genomic Location (Zv9):
Chromosome 2 (position 58182695)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57915958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACTGAGTCGCATGGATAGCGGCATGAAGAACAGCGTTTTATCAGTG[G/T]AGGTGTGTGTGTGTGTGTGTGTGTGCGTGATATATGTGATAAAGTACTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link