adck5

Ensembl ID:
ENSDARG00000075405
ZFIN ID:
ZDB-GENE-081104-149
Description:
Novel protein similar to vertebrate aarF domain containing kinase 5 (ADCK5) [Source:UniProtKB/TrEMBL
Human Orthologue:
ADCK5
Human Description:
aarF domain containing kinase 5 [Source:HGNC Symbol;Acc:21738]
Mouse Orthologue:
Adck5
Mouse Description:
aarF domain containing kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2679274]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12134 Essential Splice Site Available for shipment Available now
sa23475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Essential Splice Site 8 579 None 16
ENSDART00000145380 Essential Splice Site 34 531 None 13
Genomic Location (Zv9):
Chromosome 19 (position 12478778)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11937124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACAGCCCGAGCAGACGYGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTAYTAGTCGCTCACTTTTGCTCTTGCTCTTATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Nonsense 142 579 5 16
ENSDART00000145380 Nonsense 168 531 5 13
Genomic Location (Zv9):
Chromosome 19 (position 12495965)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11954311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTCATCAGAGAGCCGCCAGCAATATGGTGGACGGAGCCATACAGAAC[G/T]GAGGCTTGTACATTAAGCTGGGACAGGGCCTGTGTGCATTCAACCATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link