adck5

Ensembl ID:
ENSDARG00000075405
ZFIN ID:
ZDB-GENE-081104-149
Description:
Novel protein similar to vertebrate aarF domain containing kinase 5 (ADCK5) [Source:UniProtKB/TrEMBL
Human Orthologue:
ADCK5
Human Description:
aarF domain containing kinase 5 [Source:HGNC Symbol;Acc:21738]
Mouse Orthologue:
Adck5
Mouse Description:
aarF domain containing kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2679274]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4794 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12134 Essential Splice Site Available for shipment Available now
sa23475 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Essential Splice Site 8 579 None 16
ENSDART00000145380 Essential Splice Site 34 531 None 13
Genomic Location:
Chromosome 19 (position 12478778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACAGCCCGAGCAGACGYGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTATTAGTCGCTCACTTTTGCTCTTGCTCTTATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Essential Splice Site 8 579 None 16
ENSDART00000145380 Essential Splice Site 34 531 None 13
Genomic Location:
Chromosome 19 (position 12478778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACAGCCCGAGCAGACGYGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTAYTAGTCGCTCACTTTTGCTCTTGCTCTTATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Nonsense 142 579 5 16
ENSDART00000145380 Nonsense 168 531 5 13
Genomic Location:
Chromosome 19 (position 12495965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTCATCAGAGAGCCGCCAGCAATATGGTGGACGGAGCCATACAGAAC[G/T]GAGGCTTGTACATTAAGCTGGGACAGGGCCTGTGTGCATTCAACCATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h774g057