si:ch211-281g13.4

Ensembl ID:
ENSDARG00000075389
ZFIN ID:
ZDB-GENE-090311-16
Description:
hypothetical protein LOC794323 [Source:RefSeq peptide;Acc:NP_001139174]
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39681 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38291 Nonsense Mutation detected in F1 DNA During 2017
sa44512 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113049   None 757 None 21
ENSDART00000138510 Essential Splice Site 71 985 1 24
Genomic Location (Zv9):
Chromosome 1 (position 50064351)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48913532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGTGCTGAGACTGCGCGATGAAGACTGTAACCAAGATGGAAAACTAA[G/T]TATGATAAATGTAGTGTGGGTAAAGTTACTATTAAAACAGGCCCGTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113049 Nonsense 593 757 17 21
ENSDART00000138510 Nonsense 656 985 17 24
Genomic Location (Zv9):
Chromosome 1 (position 50055708)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48904889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTAGGCAATGCCACGTTCAACGTGTTGCACATAAACAGAGAGTCAT[T/A]GTTGATGGACACACTGAAGTATCTCAGGCAAAACACCCACTCATTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113049   None 757 None 21
ENSDART00000138510 Essential Splice Site 915 985 23 24
Genomic Location (Zv9):
Chromosome 1 (position 50053760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTGTTTTCTTTGAGCTCTCTGAAGAACACAAGAAGAAATTTCTAAG[T/C]AAGCTTGAATACTTTGCCTCATTTGCATAATTAAGCATTTATATTATAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link