si:ch211-281g13.4

Ensembl ID:
ENSDARG00000075389
ZFIN ID:
ZDB-GENE-090311-16
Description:
hypothetical protein LOC794323 [Source:RefSeq peptide;Acc:NP_001139174]
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39681 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38291 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113049   None 757 None 21
ENSDART00000138510 Essential Splice Site 71 985 1 24
Genomic Location (Zv9):
Chromosome 1 (position 50064351)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48913532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGTGCTGAGACTGCGCGATGAAGACTGTAACCAAGATGGAAAACTAA[G/T]TATGATAAATGTAGTGTGGGTAAAGTTACTATTAAAACAGGCCCGTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113049 Nonsense 593 757 17 21
ENSDART00000138510 Nonsense 656 985 17 24
Genomic Location (Zv9):
Chromosome 1 (position 50055708)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48904889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTAGGCAATGCCACGTTCAACGTGTTGCACATAAACAGAGAGTCAT[T/A]GTTGATGGACACACTGAAGTATCTCAGGCAAAACACCCACTCATTTTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link