kri1l

Ensembl ID:
ENSDARG00000075380
ZFIN ID:
ZDB-GENE-040915-3
Description:
Protein KRI1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ4]
Human Orthologue:
KRI1
Human Description:
KRI1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25769]
Mouse Orthologue:
Kri1
Mouse Description:
KRI1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2384899]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30604 Nonsense Mutation detected in F1 DNA During 2016
sa10565 Nonsense Available for shipment Available now
sa33139 Nonsense Mutation detected in F1 DNA During 2016
sa6032 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40037 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Nonsense 14 765 1 24
ENSDART00000111528 Nonsense 14 765 1 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19158538)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19186900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGACAACATGTCGGATCTCAAGATTAACAAGAAGTTTGCAGAGAAGTA[T/A]GAGAAATATCGCCAGAAAGAGGAACTGCAGAGACGTAAGTTGTACTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Nonsense 95 765 4 24
ENSDART00000111528 Nonsense 95 765 4 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19160432)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19188794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTACTGTACTTTTTGTTTTAATCAGCRTCTGGGTCAGGCAGCGATGAG[C/T]AACCGTCCACTTCGAAACAGTCAGAGAAACCCATGTTCCTTAAGGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Nonsense 274 765 10 24
ENSDART00000111528 Nonsense 274 765 10 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19162678)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19191040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGATGTGGATGATTCTGAGGATGAAGGAGAATCATTTCTGCATAAA[C/T]AGGAAGACTTTGAGAGGCATTACAACTTCCGCTTTGAGGAGCCTGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Essential Splice Site 446 765 14 24
ENSDART00000111528 Essential Splice Site 446 765 14 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19168145)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19196507
KASP Assay ID:
554-3794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCGGAGGAACACTACCAGCCCAACTGTGATGATCCTGACTTTATCG[T/C]AAGAGTAGACTTTTTAGCATGCTTTCTTATTCTTAACACGCAATATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Nonsense 529 765 16 24
ENSDART00000111528 Nonsense 529 765 16 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19171507)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19199869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAGTACTATAAACTGGACTTTGAGGACATCATTGATGACCTGCCGTG[C/A]AGATTTCGCTACCGAGAAGTGGTAGCCAATGACTTTGGGCTGAGCACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link