kri1l

Ensembl ID:
ENSDARG00000075380
ZFIN ID:
ZDB-GENE-040915-3
Description:
Protein KRI1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ4]
Human Orthologue:
KRI1
Human Description:
KRI1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25769]
Mouse Orthologue:
Kri1
Mouse Description:
KRI1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2384899]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10565 Nonsense Available for shipment Available now
sa6032 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Nonsense 95 765 4 24
ENSDART00000111528 Nonsense 95 765 4 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 19160432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTACTGTACTTTTTGTTTTAATCAGCRTCTGGGTCAGGCAGCGATGAG[C/T]AACCGTCCACTTCGAAACAGTCAGAGAAACCCATGTTCCTTAAGGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043883 Essential Splice Site 446 765 14 24
ENSDART00000111528 Essential Splice Site 446 765 14 19

The following transcripts of ENSDARG00000075380 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 19168145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCGGAGGAACACTACCAGCCCAACTGTGATGATCCTGACTTTATCG[T/C]AAGAGTAGACTTTTTAGCATGCTTTCTTATTCTTAACACGCAATATAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jatsg4mb