si:ch73-46j18.1

Ensembl ID:
ENSDARG00000075376
ZFIN ID:
ZDB-GENE-091117-39
Human Orthologue:
SGSM1
Human Description:
small G protein signaling modulator 1 [Source:HGNC Symbol;Acc:29410]
Mouse Orthologue:
Sgsm1
Mouse Description:
small G protein signaling modulator 1 Gene [Source:MGI Symbol;Acc:MGI:107320]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41566 Nonsense Mutation detected in F1 DNA During 2017
sa17520 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060946 Nonsense 85 1533 4 25
ENSDART00000142278   None 287 None 7
Genomic Location (Zv9):
Chromosome 10 (position 1674307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1619863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTTTATGAAGGTGGGCAAGATGTTCCCTCCAGCAGAGGATCTCTGC[C/T]GAAAGGTGCAGGAGCTGGAACAAATCATTGAAAACAAGTGAGAAACAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060946 Nonsense 239 1533 8 25
ENSDART00000142278   None 287 None 7
Genomic Location (Zv9):
Chromosome 10 (position 1678739)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1624295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCGAGCGGCAGTATGGATGACAGGCCTTCTCTCTGGGCTCGGGATTA[C/A]GTCGAATCCCTTCATCAAAACTCCAGAGCCACGCTGCTCTTCGGGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link