si:ch73-272g3.1

Ensembl ID:
ENSDARG00000075362
ZFIN ID:
ZDB-GENE-091118-27
Human Orthologue:
DFNB31
Human Description:
deafness, autosomal recessive 31 [Source:HGNC Symbol;Acc:16361]
Mouse Orthologue:
Whrn
Mouse Description:
whirlin Gene [Source:MGI Symbol;Acc:MGI:2682003]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23889 Nonsense Available for shipment Available now
sa10839 Essential Splice Site Available for shipment Available now
sa29546 Nonsense Mutation detected in F1 DNA During 2017
sa29545 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111659 Nonsense 470 939 6 12
ENSDART00000145366 Nonsense 455 924 5 11
Genomic Location (Zv9):
Chromosome 21 (position 12217082)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13918256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCCAGTTTGGTGAACCAGAGCAGGGCCATGCTGGAGGAACAGGCC[A/T]GACATCTTCTGACCGAACCGGAGAGGCAGACCATGGGTTACTACATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111659 Essential Splice Site 582 939 7 12
ENSDART00000145366 Essential Splice Site 567 924 6 11
Genomic Location (Zv9):
Chromosome 21 (position 12214274)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13915448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCTCCTCCRCCAGCTTCATGACCAACACTACCCTCAGCTCCGCAAGG[G/A]TRAGAACTCACAGNNNNWCATTATTTTAGAGCCCTATCATTATTGTTRTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111659 Nonsense 739 939 9 12
ENSDART00000145366 Nonsense 724 924 8 11
Genomic Location (Zv9):
Chromosome 21 (position 12197857)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13899031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAATGTACCCGCTCCGCCCGGTCCGCCTCCTCCTCCGCCTCCACCTT[T/A]GCCTCCACCCTCTTGCCCGGATAAACCCACCCCTTCCTCCCCAGCGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111659 Essential Splice Site 783 939 9 12
ENSDART00000145366 Essential Splice Site 768 924 8 11
Genomic Location (Zv9):
Chromosome 21 (position 12197722)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13898896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCAGAGCCCGATGTGAACGAGGTCCGGCCGCTGCCACAGGTTCGAG[G/A]TGAGAATTGGCCAGATCTGATGCATTGTGCGGCAGCTGCTGGATGTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link